View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19251_high_21 (Length: 248)
Name: NF19251_high_21
Description: NF19251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19251_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 37204357 - 37204134
Alignment:
| Q |
11 |
cagagatactagcagtaacttgattccacgaatggagaccattaaaatgcacttttagagcagagccattaaattagcacaaatgatcgccctctttaaa |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37204357 |
cagagatactagcagtgacttgattccaccaatgcagaccattaaaatgcacttttagagcagagccattaagttagcacaaatgatcgccctctttaaa |
37204258 |
T |
 |
| Q |
111 |
gagtnnnnnnn-taaagttcatatatctaagttggatgcattaacccaacggctataattcttgtatgcttgaacaatgagttgtgaattagactcaatc |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204257 |
gagtaaaaaaaataaagttcatatatctaagttggatgcattaacccaacggctataattcttgtatgcttgaacaatgagttgtgaattagactcaatc |
37204158 |
T |
 |
| Q |
210 |
cataaatgcatccatccaatcttt |
233 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37204157 |
cataaatgcatccatccaatcttt |
37204134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University