View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19251_low_18 (Length: 262)
Name: NF19251_low_18
Description: NF19251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19251_low_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 37 - 262
Target Start/End: Complemental strand, 37204622 - 37204390
Alignment:
| Q |
37 |
tggactaaaaattaaaattggtatattttgggaactaaaaacatatttaagtcatactttaataaaaacattaatcaannnnnnnn--cttgaat----- |
129 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37204622 |
tggactaaaaatgaaaattggtatatttagggaactaaaaacatatttaagtcatactttaataaaaacattaatcaactttttttttcttgaatgatat |
37204523 |
T |
|
| Q |
130 |
----ttgtaaaaataatatcaactttcaacaaagttaatattataaacgaacaactttattaattccagcaatatactcgatggcatcctgtatttagag |
225 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204522 |
aaatttgtaaaaattatatcaactttcaacaaagttaatattataaac----aactttattaattccagcaatatactcgatggcatcctgtatttagag |
37204427 |
T |
|
| Q |
226 |
atgtaggtggtaccaaactaggtacaaattaatatct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204426 |
atgtaggtggtaccaaactaggtacaaattaatatct |
37204390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University