View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19251_low_20 (Length: 250)
Name: NF19251_low_20
Description: NF19251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19251_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 47163552 - 47163429
Alignment:
| Q |
8 |
agataatactgactgtaactgagaacaatatctagcaacctctctcgttaagatttcatatagtagtgccataaattgttttgaatttaataatgtctaa |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47163552 |
agataataatgactgtaactgagaacaatatctagcaacctctctcgttaagatttcatatagtagtgcaataaattgttttgaatttaataatgtctaa |
47163453 |
T |
 |
| Q |
108 |
attgtggttgaccacaaggaaagg |
131 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47163452 |
attgtggttgaccacaaggaaagg |
47163429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 151 - 233
Target Start/End: Complemental strand, 47163353 - 47163271
Alignment:
| Q |
151 |
agtattagtttgtttcatcataaactattttcatagtttcttgactcaaactaataataaaaaatatatagtatataacctta |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47163353 |
agtattagtttgtttcatcataaattattttgatagtttcttgactcaaactaataataaaaaatatatagtatataacctta |
47163271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University