View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19251_low_22 (Length: 248)
Name: NF19251_low_22
Description: NF19251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19251_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 44737037 - 44736826
Alignment:
| Q |
22 |
tcaaaatttgaacaaacgagttgattcattttgagaaatgttgttatatagtgcgaaggaaaaaagcacgaaaaacacatgatgcatgtgaatggtagca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44737037 |
tcaaaatttgaacaaacgagttgattcattttgaggaatgttgttatatagtgcgaaggaaaaaagcacgaaaaacacatgatgcatgtgaatggtagca |
44736938 |
T |
 |
| Q |
122 |
tcatattctgtttcttcgttcatttgtaacatctcaaaacacaaatttgtacgtattattacatattaaaattcaatttcgataacctttctctggttt- |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44736937 |
tcatattctgtttcttcgttcatttgtaacatcttaaaacacaaatttgtacgtattattacatattaaaattcaatttcgataacctttctatggtttc |
44736838 |
T |
 |
| Q |
221 |
cctatcaatatt |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44736837 |
cctatcaatatt |
44736826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University