View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19251_low_27 (Length: 213)
Name: NF19251_low_27
Description: NF19251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19251_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 7197477 - 7197297
Alignment:
| Q |
17 |
caaaggaattagaggaccttgtaatggaagaatttttctttgaattttgcttaacattagaaccttcctttgatagcatcctcttaacacttgttgatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7197477 |
caaaggaattagaggaccttgtaatggaagaatttttctttgaattttgcttaacattagaaccttcctttgatagcatcctcttaacacttgttgatga |
7197378 |
T |
 |
| Q |
117 |
acctgttgaattgcttttagaaagaagtggcaaaggacataaacttctaccatatccacttccacaactactacttctctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7197377 |
acctgttgaattgcttttagaaagaagtggcaaaggacataaacttctaccatatccacttccacaactactacttctctt |
7197297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 121 - 197
Target Start/End: Complemental strand, 31483923 - 31483847
Alignment:
| Q |
121 |
gttgaattgcttttagaaagaagtggcaaaggacataaacttctaccatatccacttccacaactactacttctctt |
197 |
Q |
| |
|
|||||||||||| |||| | |||||| |||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31483923 |
gttgaattgcttctagataaaagtggtaaaggacacaaacttcttccatatccacttccacaactactacttctctt |
31483847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University