View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19252_high_12 (Length: 314)
Name: NF19252_high_12
Description: NF19252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19252_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 297
Target Start/End: Original strand, 43607303 - 43607591
Alignment:
| Q |
9 |
acatcatcatcatgcaattgcaaagccgccacgtttggatgcggatgagactttggggcatgaatctcagattaatttggaagatcgtgatcgtgttgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607303 |
acatcatcatcatgcaattgcaaagccgccacgttttgatgcggatgagactttggggcatgaatctcagattaatttggaagatcgtgatcgtgttgaa |
43607402 |
T |
 |
| Q |
109 |
agcatggcccaagataaggttcaggaggcccaagataaagttcaggaggcccaaaatgatcaacgtgacgtaggaaaaacgaagaaacaaaacgtnnnnn |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607403 |
agcatggcccaagataaggttcaggaggcccaagataaagttcaggaggcccaaaatgatcaacgtgacgtaggaaaaacgaagaaacaaaacgtaaaaa |
43607502 |
T |
 |
| Q |
209 |
nntcttcatgagtttggttcgttaagtgaataagagtttactatgacgtatgaggagtcactattttctctgtttcctgatccatgttt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607503 |
aatcttcatgagtttggttcgttaagtgaacaagagtttactatgacgtatgaggagtcactattttctctgtttcctgatccatgttt |
43607591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University