View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19252_low_13 (Length: 277)
Name: NF19252_low_13
Description: NF19252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19252_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 29574277 - 29574145
Alignment:
| Q |
1 |
ttcaatctctttgaatggttttctttgctgcttcaaacttcttataactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29574277 |
ttcaatctctttgaatggttttctttgctgcttcaaacttcttctaactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag |
29574178 |
T |
|
| Q |
101 |
ctcacatctctatgcatttctatactttcttca |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29574177 |
ctcacatctctatgcatttctatactttcttca |
29574145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 31696179 - 31696311
Alignment:
| Q |
1 |
ttcaatctctttgaatggttttctttgctgcttcaaacttcttataactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31696179 |
ttcaatctctttgaatggttttctttgctgcttcaaacttcttctaactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag |
31696278 |
T |
|
| Q |
101 |
ctcacatctctatgcatttctatactttcttca |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31696279 |
ctcacatctctatgcatttctatactttcttca |
31696311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University