View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19252_low_13 (Length: 277)

Name: NF19252_low_13
Description: NF19252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19252_low_13
NF19252_low_13
[»] chr8 (1 HSPs)
chr8 (1-133)||(29574145-29574277)
[»] chr7 (1 HSPs)
chr7 (1-133)||(31696179-31696311)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 29574277 - 29574145
Alignment:
1 ttcaatctctttgaatggttttctttgctgcttcaaacttcttataactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29574277 ttcaatctctttgaatggttttctttgctgcttcaaacttcttctaactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag 29574178  T
101 ctcacatctctatgcatttctatactttcttca 133  Q
    |||||||||||||||||||||||||||||||||    
29574177 ctcacatctctatgcatttctatactttcttca 29574145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 31696179 - 31696311
Alignment:
1 ttcaatctctttgaatggttttctttgctgcttcaaacttcttataactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31696179 ttcaatctctttgaatggttttctttgctgcttcaaacttcttctaactatggcttggtggaatttcttaagacccttctctcgttttcaggtcagtgag 31696278  T
101 ctcacatctctatgcatttctatactttcttca 133  Q
    |||||||||||||||||||||||||||||||||    
31696279 ctcacatctctatgcatttctatactttcttca 31696311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University