View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19252_low_20 (Length: 205)
Name: NF19252_low_20
Description: NF19252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19252_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 186
Target Start/End: Original strand, 29574363 - 29574422
Alignment:
| Q |
130 |
tagtaccagtattata---gattaagaatttagagagaggggacaggatgataggcagtt |
186 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29574363 |
tagtaccagtattataatagattaagaatttagagagaggggacaggatgataggcagtt |
29574422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 186
Target Start/End: Complemental strand, 31696093 - 31696034
Alignment:
| Q |
130 |
tagtaccagtattata---gattaagaatttagagagaggggacaggatgataggcagtt |
186 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31696093 |
tagtaccagtattataatagattaagaatttagagagaggggacaggatgataggcagtt |
31696034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University