View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19252_low_20 (Length: 205)

Name: NF19252_low_20
Description: NF19252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19252_low_20
NF19252_low_20
[»] chr8 (1 HSPs)
chr8 (130-186)||(29574363-29574422)
[»] chr7 (1 HSPs)
chr7 (130-186)||(31696034-31696093)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 186
Target Start/End: Original strand, 29574363 - 29574422
Alignment:
130 tagtaccagtattata---gattaagaatttagagagaggggacaggatgataggcagtt 186  Q
    ||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||    
29574363 tagtaccagtattataatagattaagaatttagagagaggggacaggatgataggcagtt 29574422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 186
Target Start/End: Complemental strand, 31696093 - 31696034
Alignment:
130 tagtaccagtattata---gattaagaatttagagagaggggacaggatgataggcagtt 186  Q
    ||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||    
31696093 tagtaccagtattataatagattaagaatttagagagaggggacaggatgataggcagtt 31696034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University