View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19253_high_3 (Length: 366)
Name: NF19253_high_3
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19253_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 19372900 - 19373135
Alignment:
| Q |
19 |
tacaggtcatgcattatgggcttgaaaaagataggcggaacttagattatttcacaaacaaaaccagattggaatcaaccggacctttgatggcaacagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19372900 |
tacaggtcatgcattatgggcttgaaaaagataggcggaacttagattatttcacaaacaaaaccaaattggaatcaaccggacctttgatggcaacagt |
19372999 |
T |
 |
| Q |
119 |
gattctgcatctctcgaatgctactcaagggggtcaaatcctctttcccgagtcagtggtgagtacggcagttcgagtttgtcttttgcgtaatatttat |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
19373000 |
gattctacatctctcgaatgctactcaagggggtcaaatcctctttcccgaatcagtggtgagtacggcagttcgagtttatcttttgcgtactatttat |
19373099 |
T |
 |
| Q |
219 |
cttttaggctaaattaaacctttggtcccttaagtc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19373100 |
cttttaggctaaattaaacctttggtcccttaagtc |
19373135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 312 - 345
Target Start/End: Original strand, 19373193 - 19373226
Alignment:
| Q |
312 |
gtcccttcagttataaatgttactttgattctct |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19373193 |
gtcccttcagttataaatgttactttgattctct |
19373226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University