View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19253_high_8 (Length: 247)
Name: NF19253_high_8
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19253_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 36733642 - 36733450
Alignment:
| Q |
1 |
acttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaagtaagatgtaaccttggtaatcaaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733642 |
acttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaagtaagatgtaaccttggtaatcaaccat |
36733543 |
T |
 |
| Q |
101 |
gttattgtaaccnnnnnnnnnngttgtagtaagtaattgaaaatatgttggttacgctgctgaattgtatc----gtatataagaaggaaaaaact |
192 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36733542 |
gttattgtaacctttttttt---tagtagtaagtaattgaaaatatgttggttacgctgctgaattgtatcgtatgtatataagaaggaaaaaact |
36733450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 240
Target Start/End: Complemental strand, 36733450 - 36733417
Alignment:
| Q |
207 |
ttatattgtagtttgtgtttgatcatattcgtta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36733450 |
ttatattgtagtttgtgtttgatcatattcgtta |
36733417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University