View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19253_low_10 (Length: 247)

Name: NF19253_low_10
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19253_low_10
NF19253_low_10
[»] chr7 (2 HSPs)
chr7 (1-192)||(36733450-36733642)
chr7 (207-240)||(36733417-36733450)


Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 36733642 - 36733450
Alignment:
1 acttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaagtaagatgtaaccttggtaatcaaccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36733642 acttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaagtaagatgtaaccttggtaatcaaccat 36733543  T
101 gttattgtaaccnnnnnnnnnngttgtagtaagtaattgaaaatatgttggttacgctgctgaattgtatc----gtatataagaaggaaaaaact 192  Q
    ||||||||||||           | ||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||    
36733542 gttattgtaacctttttttt---tagtagtaagtaattgaaaatatgttggttacgctgctgaattgtatcgtatgtatataagaaggaaaaaact 36733450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 240
Target Start/End: Complemental strand, 36733450 - 36733417
Alignment:
207 ttatattgtagtttgtgtttgatcatattcgtta 240  Q
    ||||||||||||||||||||||||||||||||||    
36733450 ttatattgtagtttgtgtttgatcatattcgtta 36733417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University