View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19253_low_11 (Length: 235)
Name: NF19253_low_11
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19253_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 30965463 - 30965254
Alignment:
| Q |
1 |
gtaaaattgatacattctatgaacattataaaatgtttgaattatctccacaatgatatggataataatgatgacaaaaaccacataagaaccatattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| | | ||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
30965463 |
gtaaaattgatacattctatgaacattataaaatgtttgaattatccccacaatggttttgataataatgatgacaaaaactacataaaaaccatattta |
30965364 |
T |
 |
| Q |
101 |
atcttttctattagatagaccactgaatcatgaccagtagtaagtccaaggttcttgtcatcctcgcattttggtggtggtggtgaaccatcacaccctc |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965363 |
atcttttctattagatagagcactgaatcatgaccagtagtaagtccaaggttcttgtcatcctcgcattttggtggtggtggtgaaccatcacaccctc |
30965264 |
T |
 |
| Q |
201 |
ctccacaatc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
30965263 |
ctccacaatc |
30965254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University