View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19253_low_4 (Length: 380)
Name: NF19253_low_4
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19253_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 238 - 374
Target Start/End: Original strand, 30965663 - 30965799
Alignment:
| Q |
238 |
acagagtgagagtctgaatcaatttttctatgttaattagcaagactattttatcatgttgaccactttcacttttttcatgtcacaaatattttactgt |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965663 |
acagagtgagagtctgaatccatttttctatgttaattaacaagactattttatcatgttgaccactttcacttttttcatgtcacaaatattttactgt |
30965762 |
T |
|
| Q |
338 |
ttgcatgaatatgaaagaattaacgtttgatgatgtc |
374 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
30965763 |
ttgcatgaatatgaaagaattaatgtttcatgatgtc |
30965799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 30965452 - 30965534
Alignment:
| Q |
1 |
tatcaattttactttggagagggccgtgagcagcgcttgaggatgaagtagaaaagggatgaaagaaaaattagagaggcaat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
30965452 |
tatcaattttactttggagagggccgtgagcagcgcttgaggatgaaggagaaaagggatgaaagaaaaattagagagacaat |
30965534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University