View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19253_low_5 (Length: 366)

Name: NF19253_low_5
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19253_low_5
NF19253_low_5
[»] chr6 (2 HSPs)
chr6 (19-254)||(19372900-19373135)
chr6 (312-345)||(19373193-19373226)


Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 19372900 - 19373135
Alignment:
19 tacaggtcatgcattatgggcttgaaaaagataggcggaacttagattatttcacaaacaaaaccagattggaatcaaccggacctttgatggcaacagt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
19372900 tacaggtcatgcattatgggcttgaaaaagataggcggaacttagattatttcacaaacaaaaccaaattggaatcaaccggacctttgatggcaacagt 19372999  T
119 gattctgcatctctcgaatgctactcaagggggtcaaatcctctttcccgagtcagtggtgagtacggcagttcgagtttgtcttttgcgtaatatttat 218  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||    
19373000 gattctacatctctcgaatgctactcaagggggtcaaatcctctttcccgaatcagtggtgagtacggcagttcgagtttatcttttgcgtactatttat 19373099  T
219 cttttaggctaaattaaacctttggtcccttaagtc 254  Q
    ||||||||||||||||||||||||||||||||||||    
19373100 cttttaggctaaattaaacctttggtcccttaagtc 19373135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 312 - 345
Target Start/End: Original strand, 19373193 - 19373226
Alignment:
312 gtcccttcagttataaatgttactttgattctct 345  Q
    ||||||||||||||||||||||||||||||||||    
19373193 gtcccttcagttataaatgttactttgattctct 19373226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University