View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19253_low_9 (Length: 286)
Name: NF19253_low_9
Description: NF19253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19253_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 133 - 276
Target Start/End: Complemental strand, 36733429 - 36733286
Alignment:
| Q |
133 |
atcatattcgttatttgatttggaaaaggacgattatgtgttgctctcaannnnnnnnaggaaggccaaggacggcaacatattcttaaaacgtatgact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733429 |
atcatattcgttatttgatttggaaaaggacgattatgtgttgctctcaagtttttttaggaaggccaaggacggcaacatattcttaaaacgtatgact |
36733330 |
T |
|
| Q |
233 |
gattccaaactaggaagaatataaaatgtcaccgaatgtctgtg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733329 |
gattccaaactaggaagaatataaaatgtcaccgaatgtctgtg |
36733286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 4 - 70
Target Start/End: Complemental strand, 36733520 - 36733450
Alignment:
| Q |
4 |
gtagtaagtaattgaaaatatgttggttacgctgctgaattgtatc----gtatataagaaggaaaaaact |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36733520 |
gtagtaagtaattgaaaatatgttggttacgctgctgaattgtatcgtatgtatataagaaggaaaaaact |
36733450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 85 - 118
Target Start/End: Complemental strand, 36733450 - 36733417
Alignment:
| Q |
85 |
ttatattgtagtttgtgtttgatcatattcgtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36733450 |
ttatattgtagtttgtgtttgatcatattcgtta |
36733417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University