View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19255_high_13 (Length: 253)
Name: NF19255_high_13
Description: NF19255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19255_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 126 - 236
Target Start/End: Original strand, 30607702 - 30607812
Alignment:
| Q |
126 |
tatatcttcatattgatgataatagatcatccaaaaatgataatgttgaagagaaattgtaatatctcaatcgtaaaacttatctcataattattttgct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30607702 |
tatatcttcatattgatgataatagatcatccaaaaatgataatgttgaagagaaattgtaatatctcaatcgtaaaacttatctcataattattttgct |
30607801 |
T |
 |
| Q |
226 |
aagatgtatga |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
30607802 |
aagatgtatga |
30607812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 30607577 - 30607671
Alignment:
| Q |
1 |
caacctagttgaaggatgataatcaagataaactttatgtacggatagaaagctatttccaatatcaaactggtatgtcgatccagctttggtat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30607577 |
caacctagttgaaggatgataatcaagataaactttatgtacggatagaaagctatttccaatatcaaactggtatgtcgatccagctttggtat |
30607671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University