View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19255_high_16 (Length: 236)

Name: NF19255_high_16
Description: NF19255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19255_high_16
NF19255_high_16
[»] chr5 (1 HSPs)
chr5 (1-119)||(14680005-14680123)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 14680123 - 14680005
Alignment:
1 ttctctacttttcttgttaaaccaaatctatggtgttgtcctgtcaattcactgtttaattagtgaattgattgcttgaatatgaatccacatgcttctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
14680123 ttctctacttttcttgttaaaccaaatctatggtgttgtcctgtcaattcactgtttaattagtgaattgattgcttgaatatgaatccccatgcttctc 14680024  T
101 taatctagaaataatcatt 119  Q
    |||||||||||||||||||    
14680023 taatctagaaataatcatt 14680005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University