View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19255_low_15 (Length: 251)

Name: NF19255_low_15
Description: NF19255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19255_low_15
NF19255_low_15
[»] chr3 (1 HSPs)
chr3 (1-137)||(30607357-30607493)


Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 30607493 - 30607357
Alignment:
1 cctatcggtgttttaaaaaacgaaccgacatgttcaactgatttagttgagaatcagtctatttaactgattattataatctcatttgaatcagagttta 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||    
30607493 cctatcggtgttttaaaaatcgaaccgacatgttcaactgatttagttgagaatcagtctatttaaccgattattataatctcatttaaatcagagttta 30607394  T
101 gtcgaacatgaaaatcaaattggggttgaataaacca 137  Q
    ||||||||||||||||  |||||||||||||||||||    
30607393 gtcgaacatgaaaatcggattggggttgaataaacca 30607357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University