View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19255_low_4 (Length: 434)
Name: NF19255_low_4
Description: NF19255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19255_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 20 - 424
Target Start/End: Complemental strand, 299053 - 298649
Alignment:
| Q |
20 |
cacattgcattttcaacttcactaagtatatcttctgattcaaaatcttgtacgcccatattcgtcctaaatttagcctcaccgtgtctgctctgaccac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
299053 |
cacattgcattttcaacttcactaagtatatcttctgattcaaaatcttgtacacccatattcgtcctaaatttagcttcaccgtgtctgctctgaccac |
298954 |
T |
 |
| Q |
120 |
cattaacttgaccattggcaatacttgtattatttatcctctctcttctccccctactttccttgaacctatctctagcttcatcagagccatcaaaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
298953 |
cattaacttgaccattggcaatacttgtattatttatcctctctcttctccccctactttccttgaacctacctctagcttcatcagagccatcaaaatt |
298854 |
T |
 |
| Q |
220 |
gctgtcaacatcactgtcatcggcaatattaccaggatgccactcatcatcgtcgtcgtcattgtcagaatgagcattctcttcatcgtcactatcggca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298853 |
gctgtcaacatcactgtcatcggcaatattaccaggatgccactcatcatcgtcgtcgtcattgtcagaatgagcattctcttcatcgtcactatcggca |
298754 |
T |
 |
| Q |
320 |
gtccgatgcttgggatgtatattctgccgaactcttgagcctctaacctcaccatcatttctagaatcgtccaatcttctgaatcttccaccatactctt |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298753 |
gtccgatgcttgggatgtatattctgccgaactcttgagcctctaacctcaccatcatttctagaatcgtccaatcttctgaatcttccaccatactctt |
298654 |
T |
 |
| Q |
420 |
ctctg |
424 |
Q |
| |
|
||||| |
|
|
| T |
298653 |
ctctg |
298649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University