View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19255_low_7 (Length: 290)
Name: NF19255_low_7
Description: NF19255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19255_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 51466 - 51251
Alignment:
| Q |
1 |
gaattaaaagctatgtgacaatattgaattattttatagtgtatactataaagtttttcacaatcaaagtggcataatgaaactttcttgttctgacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51466 |
gaattaaaagctatgtgacaatattgaattattttatattgtatactctaaagtttttcacaatcaaagtggcataatgaaactttcttgttctgacaag |
51367 |
T |
|
| Q |
101 |
taataataatactttaggtttatgaacgccaccgcaacattagagcagtcagcaaatttaattttgcttgtggaaaagaaaagtaaacggatgtattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51366 |
taataataatactttaggtttatgaacgacaccgcaacattagagcagtcagcaaatttaattttgcttgtggaaaagaaaagtaaacagatgtattatt |
51267 |
T |
|
| Q |
201 |
ttatgcaaaaattgat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51266 |
ttatgcaaaaattgat |
51251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University