View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19256_low_15 (Length: 262)
Name: NF19256_low_15
Description: NF19256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19256_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 53558993 - 53558755
Alignment:
| Q |
20 |
gtatgaggactaataaatgtaaaagagattaaataaatcgcttattttaaatttgtggaaacaaaattgcacaattacgaaacttggggttcaagagtcg |
119 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53558993 |
gtattaggactaataaatgtaaaagaggttaaataaatcgcttattttaaatttgtggaaacaaaattgcacaattacgaaacttgaggttcaagagtcg |
53558894 |
T |
 |
| Q |
120 |
agagtgtaatttaagacttatgtttttcctaatttttatttgaacattgatctttgagtttcaatatggttttatctttgagtgatattatgaaagattt |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
53558893 |
agagtgtaatttaagacttgtgtttttcctaatttttatttgaacattgatctttgagtttcaatatggttttatctttgagtggtattttgaaagattt |
53558794 |
T |
 |
| Q |
220 |
tttaatactttcattgcaaatttcaaaaagttcatgcat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53558793 |
tttaatactttcattgcaaatttcaaaaagttcatgcat |
53558755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University