View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19256_low_17 (Length: 247)

Name: NF19256_low_17
Description: NF19256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19256_low_17
NF19256_low_17
[»] chr6 (1 HSPs)
chr6 (17-195)||(23930654-23930832)


Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 23930832 - 23930654
Alignment:
17 aatatcgtcactagagaatgtggaaaatgctgaagatgaatttagtatgcagaagcagaatttgcagaaaacattagcagctaacaatttgccactcact 116  Q
    |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23930832 aatatcatcactagagaatgtggaaaatgctgcagatgaatttagtatgcagaagcagaatttgcagaaaacattagcagctaacaatttgccactcact 23930733  T
117 actactactactatctcaaagacagacgcagtggtcgatgaagagaatagaactccaaaagaaaagcctattcctgtct 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
23930732 actactactactatctcaaagacagacgcagtggtcgatgaagagaatagaactccaaaagaaaatcctattcctgtct 23930654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University