View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19256_low_17 (Length: 247)
Name: NF19256_low_17
Description: NF19256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19256_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 23930832 - 23930654
Alignment:
| Q |
17 |
aatatcgtcactagagaatgtggaaaatgctgaagatgaatttagtatgcagaagcagaatttgcagaaaacattagcagctaacaatttgccactcact |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23930832 |
aatatcatcactagagaatgtggaaaatgctgcagatgaatttagtatgcagaagcagaatttgcagaaaacattagcagctaacaatttgccactcact |
23930733 |
T |
|
| Q |
117 |
actactactactatctcaaagacagacgcagtggtcgatgaagagaatagaactccaaaagaaaagcctattcctgtct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23930732 |
actactactactatctcaaagacagacgcagtggtcgatgaagagaatagaactccaaaagaaaatcctattcctgtct |
23930654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University