View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19257_high_10 (Length: 232)
Name: NF19257_high_10
Description: NF19257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19257_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 47705431 - 47705629
Alignment:
| Q |
17 |
gaaagcaagtatagaacgattatttgggtctttgcttggaattggtgagctcaacttgtaaccttgtaggttcatttcaggcattgagacatctctttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705431 |
gaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctcaacttgtaaccttgtaggttcatttcaggcattgagacatctctttta |
47705530 |
T |
|
| Q |
117 |
ggatcaaacccttcagaagtgttggcattgcataacacttttattaagttcttgaaaagctctttgcctgaactctctcttgagatttctggtgcctgc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705531 |
ggatcaaacccttcagaagtgttggcattgcataacacttttattaagttcttgaaaagctctttgcctgaactctctcttgagatttctggtgcctgc |
47705629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 47728258 - 47728307
Alignment:
| Q |
123 |
aacccttcagaagtgttggcattgcataacacttttattaagttcttgaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| || | ||||| ||||| |
|
|
| T |
47728258 |
aacccttcagaagtgttggcattgcataagactcttgtgaagtttttgaa |
47728307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University