View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19258_high_21 (Length: 238)
Name: NF19258_high_21
Description: NF19258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19258_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 156 - 219
Target Start/End: Complemental strand, 40622020 - 40621957
Alignment:
| Q |
156 |
cttccaatgttaaaaaactatacatttttgtagaagaatagttcataatgttttaaacatgctt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40622020 |
cttccaatgttaaaaaactatacatttttgtagaagaatagatcataatgttttaaacatgctt |
40621957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 40622146 - 40622095
Alignment:
| Q |
30 |
atagacatgtttaacatattataaaaagttcgttcgcaaagaataagctgaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40622146 |
atagacatgtttaacatattataaaaagttcgttcgtaaagaataagctgaa |
40622095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University