View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19258_low_14 (Length: 262)
Name: NF19258_low_14
Description: NF19258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19258_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 35095759 - 35096009
Alignment:
| Q |
1 |
aatgtcattcatcgagagaaaagagttgatagacaacccaatatatgctaaactatcggcaccacaatttccttctctaaatatacgagagactatgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095759 |
aatgtcattcatcgagagaaaagagttgatagacaacccaatatatgctaaactatcggcaccacaatttccttctctaaatatacgagagactatgaag |
35095858 |
T |
 |
| Q |
101 |
ttcatttgttttgttaaatcaatgcaattttcccatctattccttatgttttatggaacaaaggacgaagacttaacagaaccaatgtcgaatcagtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35095859 |
ttcatttgttttgttaaatcaatgcaattttcccatctattccttatgttttatggaacaaaggacgaaggcttaacagaaccaatgtcgaatcagtttc |
35095958 |
T |
 |
| Q |
201 |
taaccatagattagtccagcctttgttgtaagctatctcaattgcattcat |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35095959 |
taaccatagattagtccagcctttattgtaagctatctcaattgcattcat |
35096009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University