View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19258_low_16 (Length: 255)
Name: NF19258_low_16
Description: NF19258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19258_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 255
Target Start/End: Complemental strand, 40622663 - 40622417
Alignment:
| Q |
9 |
gagaagaagatgaatgaaactgaaaaagggtgtgttgtgtttaactagttcaaccaagtaatataataataatttagaatttcttttttactaaaaatag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40622663 |
gagaagaagatgaatgaaactgaaaaagggtgtgttgtgtttaactagttcaaccaagtaatataataataatttagaatttcttttttactaaaaatag |
40622564 |
T |
 |
| Q |
109 |
agggttcatctctgtatatgtagcttgagaaaggaaagaaagaagataattgtcataataaggacaggctgttggttgctttcaacttttaataatagtc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40622563 |
agggttcatctctgtatatgtagcttgagaaaggaaagaaagaagataattgtcataataaggacaggctgttggttgctttcaacttttaataatagtc |
40622464 |
T |
 |
| Q |
209 |
aggaaaagacaagtacaaagaaagaatggatgctcatgacaaactaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40622463 |
aggaaaagacaagtacaaagaaagaatggatgctcatgacaaactaa |
40622417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 199
Target Start/End: Complemental strand, 45409572 - 45409536
Alignment:
| Q |
163 |
ataataaggacaggctgttggttgctttcaactttta |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45409572 |
ataataaggacagcctgttggttgctttcaactttta |
45409536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University