View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19258_low_21 (Length: 241)
Name: NF19258_low_21
Description: NF19258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19258_low_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 35095433 - 35095659
Alignment:
| Q |
17 |
aggattaatgtgaaggctgaattctcaaacaaatgctgttatttacgttaaaagtcctcactttaaaggagctggatggactctaaaaaataaatacttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35095433 |
aggattaatgtgaaggctgaattctcaaacaaatgctgttatttacgttaaaagtcctcactttaaaggagctggatggactctaaaaaagaaatacttt |
35095532 |
T |
|
| Q |
117 |
tgtgttaacaaaagacatcaatg-nnnnnnnnnnaaatccaataattttgattcagttgctataaatgtcttttcacccttaacaa-nnnnnnnnnnaat |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
35095533 |
tgtgttaacaaaagacatcaatgtttttttttttaaatccaataattttgattcagttgctataaatgtcttttcacccttagcaatttttttttttaat |
35095632 |
T |
|
| Q |
215 |
aaactgatgatgcagaaagcatcacct |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35095633 |
aaactgatgatgcagaaagcatcacct |
35095659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University