View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19259_high_11 (Length: 311)
Name: NF19259_high_11
Description: NF19259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19259_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 41 - 244
Target Start/End: Complemental strand, 38082511 - 38082308
Alignment:
| Q |
41 |
taaatgttagtatcttggttggaaacttgcaccatataagatatgttgaacagtatatgtgattccactttacttttaaatgtatttctatttatgtact |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38082511 |
taaatgttagtatcttggttggaaacttgcaccatataagatatgttgaacagtatatgtgattccactttacttttaaatgtatttctatttctgtact |
38082412 |
T |
 |
| Q |
141 |
acttgaagaaaaattcatgtgggacaatagtacttcttttcctttcctttttgcgtttatttaactgcctcaatgacaccccttcctaattagaagagtc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38082411 |
gcttgaagaaaaattcatgtgggacaatagtacttcttttcctttcctttttgcgtttatttaactgcatcaatgacaccccttcctaattagaagagtc |
38082312 |
T |
 |
| Q |
241 |
aatt |
244 |
Q |
| |
|
|||| |
|
|
| T |
38082311 |
aatt |
38082308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University