View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19259_low_26 (Length: 239)
Name: NF19259_low_26
Description: NF19259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19259_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 32666427 - 32666635
Alignment:
| Q |
12 |
agcagagagtaaacaacagataagcttttttcagtcagaaacatgacctaccaagcagttcagtaattatgcattgttgatatattactaaagcactaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32666427 |
agcagagagtaaacaacagataagcttttttcagtcagaaacatgacctaccaagcagttcagtaattatgcattgttgatatataactaaagcactaaa |
32666526 |
T |
 |
| Q |
112 |
cctaagttcatattttatatcaagtgaggcagttgaactgcagctaatcttaccatatgttgtgatatttccattggaaacaggtttaattagtgccaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666527 |
cctaagttcatattttatatcaagtgtggcagttgaactgcagctaatcttaccatatgttgtgatatttccattggaaacaggtttaattagtgccaga |
32666626 |
T |
 |
| Q |
212 |
tcattgcct |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
32666627 |
tcattgcct |
32666635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University