View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1925R-Insertion-3 (Length: 350)
Name: NF1925R-Insertion-3
Description: NF1925R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1925R-Insertion-3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 9 - 304
Target Start/End: Original strand, 10714660 - 10714955
Alignment:
| Q |
9 |
aaggctgcctgcttgctttgcaagaggatttgggttagaagtcgccccttacgctgtgttatgtgatccgaatcagaatgagatcgaagtggccattgag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10714660 |
aaggctgcctgcttgctttgcaagaggatttgggttagaagtcgccccttacgctgtgttatgtgatccgaatcagaatgagatcgaagtggccattgag |
10714759 |
T |
|
| Q |
109 |
aagaggaatggtaggtttttattgcagatggctgggagatcctaaagaggttttataagattttttccggcacttggatcacggtggtgtacgcagatag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10714760 |
aagaggaatggtaggtttttattgcagatggctgggagatcctaaagaggttttataagattttttccggcacttggatcacggtggtgtacgcagatag |
10714859 |
T |
|
| Q |
209 |
acacctttttgtgttggaagtcagagatttccatggacaagaattggtgtatccacaattcactcctcctcaaagattgctgctggagaatcatag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10714860 |
acacctttttgtgttggaagtcagagatttccatggacaagaattggtgtatccacaattcactcctcctcaaagattgctgctggagaatcatag |
10714955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University