View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1925R-Insertion-4 (Length: 301)
Name: NF1925R-Insertion-4
Description: NF1925R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1925R-Insertion-4 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 151 - 301
Target Start/End: Complemental strand, 33781169 - 33781019
Alignment:
| Q |
151 |
ctgtactttgttggtgtgtagatattcttccaggatggagggagacaatggaaaagtttcacagagaagcattgtaagtacaagtgatgatatgtttctg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781169 |
ctgtactttgttggtgtgtagatattcttccaggatggagggagacaatggaaaagtttcacagagaagcattgtaagtacaagtgatgatatgtttctg |
33781070 |
T |
|
| Q |
251 |
taataagattataagatgcagtatgtagcacggcactttaaattaaaggcg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33781069 |
taataagattataagatgcagtatgtagcacagcactttaaattaaaggcg |
33781019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 33781311 - 33781221
Alignment:
| Q |
9 |
gacccagaatcaaataaacccttttatgggcctaataaatggcctgcaccaggtaaagagttaaaaaacttacctttagaggaaaaatatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781311 |
gacccagaatcaaataaacccttttatgggcctaataaatggcctgcaccaggtaaagagttaaaaaacttacctttagaggaaaaatatg |
33781221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University