View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1925R-Insertion-5 (Length: 282)
Name: NF1925R-Insertion-5
Description: NF1925R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1925R-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 31634856 - 31634625
Alignment:
| Q |
8 |
agttacaccattttggatttagcagctaaattccaaaggccattatatccctagtttttgtctccatgacaaacttggctccacaatggtcatcatgtag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31634856 |
agttacaccattttggatttagcagctaaattccaaaggccatcatatccctagtttttgtctccatgacaaacttggctccacaatgg---tcatgtag |
31634760 |
T |
|
| Q |
108 |
gccaagttaaatttagctaagaacttttgttaattctattcaaactgaaacagatcattaaccgtagcccgtgaatttgtagg----ttaactacttgta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
31634759 |
gccaagttaaatttagctaagaacttttgttaattctattcaaaccgaaacagatcattaattgtagcccgtgaatttgtaggttacttaactacttgta |
31634660 |
T |
|
| Q |
204 |
attaccgtcccctaaaatattattatggattgctc |
238 |
Q |
| |
|
|||||| |||||| |||||||||||||| |||||| |
|
|
| T |
31634659 |
attaccatcccctcaaatattattatgggttgctc |
31634625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University