View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1925R-Insertion-7 (Length: 260)
Name: NF1925R-Insertion-7
Description: NF1925R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1925R-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 39900156 - 39899995
Alignment:
| Q |
9 |
caactaaagttcaaacggttcaatccggttgtggttcaattgagatcaaaccaaccgacaatttaactgggtcaatcagattcttaaaacattgcaccga |
108 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39900156 |
caactaaagttcaaacggttcaatccgattgcggttcaattgagatcaaaccaaccgacaatttacctgggtcaatcagattcttaaaacattgcaccga |
39900057 |
T |
|
| Q |
109 |
atttattagcaatcatgcaattcacttgctttgaatgagaacaaaattttatgtgcatacac |
170 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
39900056 |
atttattagcaatcatgcaattcacttgttttgaatgagaacaaaattttatgtacatacac |
39899995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 197 - 260
Target Start/End: Complemental strand, 39899967 - 39899904
Alignment:
| Q |
197 |
tgctacaacggaagttatgtatttgctccattgttgctttatatgatccatgattgtgtccgtt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39899967 |
tgctacaacggaagttatgtatttgctccattgttgctttatatgatccatgattgtgtccgtt |
39899904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University