View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1925R-Insertion-9 (Length: 218)
Name: NF1925R-Insertion-9
Description: NF1925R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1925R-Insertion-9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 40593398 - 40593608
Alignment:
| Q |
8 |
aaataaagcgttactaatttatcaaaggagtttggatctaccggaaggagccagacttctccgaagagaccaatcaatgttcaaattctgcctagaagat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40593398 |
aaataaagcgttactaatttatcaaaggagtttggatctaccggaaggagccagacttctccgaagagaccaatcaatgttcaaattctgcctagaagat |
40593497 |
T |
 |
| Q |
108 |
atattcatatttagtgtctaacggcgtctcaaatagtaaaaccaaacaatgtgtaatgatttgcactacacaaaaatctagctaaaacattggaagcaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40593498 |
atattcatatttagtgtctaacggtgtctcaaatagtaaaaccaaacaatgtgtaatgatttgcactacacaaaaatctagctaaaacattggaagcaaa |
40593597 |
T |
 |
| Q |
208 |
ttttatctacc |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
40593598 |
ttttatctacc |
40593608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University