View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1925_high_3 (Length: 238)
Name: NF1925_high_3
Description: NF1925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1925_high_3 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 38 - 224
Target Start/End: Complemental strand, 41406535 - 41406348
Alignment:
| Q |
38 |
cattttctactatagaa-cacatgcttcgaaactaccaagnnnnnnncttacaaactacaaggaacaacaagagtaaacataaaatttgaacctatgatt |
136 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41406535 |
cattttctactatagaaacacatgcttcgaaactaccaagttttttacttacaaactacaaggaacaacaagagtaaacataaaatttgaacctatgatt |
41406436 |
T |
 |
| Q |
137 |
tatagtatcaatagccaaacctcttaccactagtctaattaatcacagtggtttcttccaaattacaagcaacctctgatataatatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41406435 |
tatagtatcaatagccaaacctcttaccactagtctaattaatcacagtggtttcttccaaattacaagcaacctctgatataatatt |
41406348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 28713143 - 28713185
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
28713143 |
tctctcatattcacattatcttcttattttctctcttcatttt |
28713185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 28720490 - 28720532
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
28720490 |
tctctcatattcacattatcttcttattttctctcttcatttt |
28720532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 28728132 - 28728174
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
28728132 |
tctctcatattcacattatcttcttattttctctcttcatttt |
28728174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 30925675 - 30925633
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
30925675 |
tctctcatattcacattatcctcttattttctctcttcctttt |
30925633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 32175004 - 32175046
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
32175004 |
tctctcatactcacattatcctcttattctctctcttcatttt |
32175046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 41406877 - 41406835
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
41406877 |
tctctcatactcacattatcctcttattctctctcttcatttt |
41406835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 31249343 - 31249301
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31249343 |
tctctcatatttacattatcctcttattctctctcttcatttt |
31249301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 32687979 - 32687939
Alignment:
| Q |
3 |
tctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32687979 |
tctcatatttacattatcttcttattctctctcttcatttt |
32687939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 11404981 - 11404939
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
11404981 |
tctctcatacttacattatcctcttattctctctcttcttttt |
11404939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 32717610 - 32717570
Alignment:
| Q |
3 |
tctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
32717610 |
tctcatacttacattatcctcttattctctctcttcttttt |
32717570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 14206439 - 14206481
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
14206439 |
tctctcatactcacattatcctcttattatctctcttcatttt |
14206481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 14073101 - 14073143
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
14073101 |
tctctcatacttacattatcctcttattctctctctttatttt |
14073143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 43
Target Start/End: Original strand, 21749264 - 21749301
Alignment:
| Q |
6 |
catatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
21749264 |
catattcacattatcctcttattctctctcttcatttt |
21749301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 8577523 - 8577481
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
8577523 |
tctctcatatttacattatcttcttattctctctcttcatttt |
8577481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 8391357 - 8391317
Alignment:
| Q |
3 |
tctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
8391357 |
tctcatacttacattatcctcttattctctctcttcatttt |
8391317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 31703499 - 31703457
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
31703499 |
tctctcatactcacattatcctcttattctctctcttcatttt |
31703457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 37843453 - 37843411
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
37843453 |
tctctcatactcacattatactcttattatctctcttcatttt |
37843411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 48872972 - 48872930
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
48872972 |
tctctcatactcacattatcctcttattctctctcttcatttt |
48872930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 18054 - 18096
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
18054 |
tctctcatacttacattatactcttattctctctcttcatttt |
18096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 43657065 - 43657107
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
43657065 |
tctctcatattcacattatcctcttattctctctcttcctttt |
43657107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 47425006 - 47424964
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
47425006 |
tctctcatactcacattatcctcttattatctctcttcctttt |
47424964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 1580304 - 1580262
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
1580304 |
tctctcatactcacattatcctcttattatctctcttcttttt |
1580262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 42169745 - 42169703
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcatttt |
43 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||| |
|
|
| T |
42169745 |
tctctcatactcacattatcctcttattctctctcttcatttt |
42169703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 9954598 - 9954635
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttc |
38 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
9954598 |
tctctcatacttacattatcctcttattctctctcttc |
9954635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 5091 - 5047
Alignment:
| Q |
1 |
tctctcatatttacattatcctcttattatctctcttcattttct |
45 |
Q |
| |
|
||||||||||||| |||||| ||||||| | |||||||||||||| |
|
|
| T |
5091 |
tctctcatatttatattatcttcttattctttctcttcattttct |
5047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University