View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19261_high_13 (Length: 239)
Name: NF19261_high_13
Description: NF19261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19261_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 30 - 88
Target Start/End: Original strand, 41087757 - 41087815
Alignment:
| Q |
30 |
cctttagtttgtaccattaacttgcaaccaattttctaaactatagttataattctata |
88 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41087757 |
cctttagtttgtaacattaacttgcaaccaattttctaaactatagttataattctata |
41087815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University