View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19261_high_7 (Length: 322)
Name: NF19261_high_7
Description: NF19261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19261_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 127 - 308
Target Start/End: Original strand, 28425698 - 28425872
Alignment:
| Q |
127 |
ccgctttgcagatctagcttctcatgctttgagctgccagcaacccatatattaactatagagtttacttgctttgattctcagctctagttattctcta |
226 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28425698 |
ccgctttgca-atctaacttctcatgttttgagctgccaacaacccatatattgactatagagtttacttgctttgattctcagctctagttattctcca |
28425796 |
T |
|
| Q |
227 |
tcgctatatatgtaatgggattcccatcgtattgccatgtctatgacatatatgtatattttgattccaatacattatttgt |
308 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28425797 |
tcgctatatatgtaattggattcccatcgtattgctatgtctatgaca------tatattttgattccaatacattatttgt |
28425872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 181
Target Start/End: Complemental strand, 2955940 - 2955883
Alignment:
| Q |
126 |
accgctttgcagatctagcttctcatgctttgagctgccag--caacccatatattaa |
181 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
2955940 |
accgctttgcagatctaacttctcatgtcttgagctgccagtataacccatatattaa |
2955883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University