View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19261_low_13 (Length: 239)

Name: NF19261_low_13
Description: NF19261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19261_low_13
NF19261_low_13
[»] chr8 (1 HSPs)
chr8 (30-88)||(41087757-41087815)


Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 30 - 88
Target Start/End: Original strand, 41087757 - 41087815
Alignment:
30 cctttagtttgtaccattaacttgcaaccaattttctaaactatagttataattctata 88  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
41087757 cctttagtttgtaacattaacttgcaaccaattttctaaactatagttataattctata 41087815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University