View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19261_low_16 (Length: 227)
Name: NF19261_low_16
Description: NF19261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19261_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 5259589 - 5259815
Alignment:
| Q |
1 |
ttctcatttgctgcctgaccataactattgtaaccccatccatgtattcggccatctctcatacaaataagagtgtgagaatgtccacatgcaacaagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5259589 |
ttctcatttgctgcctgaccataactattataaccccatccatgtattcggccatctctcatacaaataagagtgtgagaatgtccacatgcaacaagtt |
5259688 |
T |
 |
| Q |
101 |
gcacgccttttggaatgactaaaactggaatatttcggaaaaatgtccgagagtcattagggatacacgagaacaatccagtgtcagggccaaggcctaa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5259689 |
gcacgccttttggaacaactaaaactggaatgtttcggaaaaatgtccgagagtcattagggatacacgagaacaatccagtgtcagggccgaggcctaa |
5259788 |
T |
 |
| Q |
201 |
ctgaccagattgacctccaccccaagc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5259789 |
ctgaccagattgacctccaccccaagc |
5259815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University