View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19261_low_9 (Length: 266)
Name: NF19261_low_9
Description: NF19261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19261_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 37502839 - 37503079
Alignment:
| Q |
8 |
cagcacagactatgagacagaagcagaaacgagctgttgctccaattatagagatagatggttgaaacctgatccaaatatgctgtaatgcaatatcaat |
107 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37502839 |
cagcgcagactatgaggcagaagcagaaacgagctgttactccaattatagagatagatggttgaaacctgatccaaatatgctgtaatgcaatatcaat |
37502938 |
T |
 |
| Q |
108 |
gcctcattttccaatgctagtaatggagaaggcattggtgcctgcatcagaaatgattcgagtggttttgtgcgtgttaaaacagaattgttttttccaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37502939 |
gcctcattttccaatgctagtaatggagaaggcattggtgcctgcatcagaaatgattcgagtggtttcgtgcgtgttaaaacagaattgttttttccaa |
37503038 |
T |
 |
| Q |
208 |
atttgtttggtggacgaaggagaaccatgtggatcattgtg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37503039 |
atttgtttggtggacgaaggagaaccatgtggatcattgtg |
37503079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University