View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19262_low_3 (Length: 409)
Name: NF19262_low_3
Description: NF19262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19262_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 2380584 - 2380448
Alignment:
| Q |
1 |
atgtaattaagacctagtgatataaatattgtgtggaattgaaacagacttcctcaaaagacnnnnnnngtattcttcaattgaaatttatcctaagaga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2380584 |
atgtaattaagacctaatgatataaatattgtgtggaactgaaacagacttcctcaaaagactttttt-gtattcttcaattgaaatttatcctaagaga |
2380486 |
T |
 |
| Q |
101 |
atatccgaacatacaaataaacactaccgtaaaaataa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2380485 |
atatccgaacatacaaataaacactaccataaaaataa |
2380448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 253 - 293
Target Start/End: Complemental strand, 2429083 - 2429043
Alignment:
| Q |
253 |
gtgtccgggttcaaacaccgaaccttacatatataatgcat |
293 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| |||||| |
|
|
| T |
2429083 |
gtgttcgggttcaaagaccgaaccttacatatattatgcat |
2429043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University