View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19263_high_6 (Length: 455)
Name: NF19263_high_6
Description: NF19263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19263_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 8 - 439
Target Start/End: Original strand, 43606876 - 43607304
Alignment:
| Q |
8 |
tgaactaaactaagagtctaagacatattcctaattcaatggctgaaactctcagggatgactactacggttaccacnnnnnnnnnnnnnnnnnnnnnaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43606876 |
tgaactaaactaagagtctaagacatattcctaattcaatggctgaaactctcagggatgactactacggttaccaccagcagcagcagcagcag---aa |
43606972 |
T |
|
| Q |
108 |
ccaacccataacattcacccaaacaagaacaaggaagggatttcatccttctacttcacaactcatagtacttgctactcttgtaccttttggagcaact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43606973 |
ccaacccataacattcacccaaacaagaacaaggaagggatttcatccttctacttcacaactcatagtacttgctactcttgtaccttttggagcaact |
43607072 |
T |
|
| Q |
208 |
cttctcattcttgctggtctcacactcactgccaccgttgtcggcctcgctgtcaccacccctctgttcattttcttcagccccattttgttagctgcgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607073 |
cttctcattcttgctggtctcacactcactgccaccgttgtcggcctcgctgtcaccacccctctgttcattttcttcagccccattttgttagctgcgg |
43607172 |
T |
|
| Q |
308 |
ctgtcgtcattggtttggccatcgccggatttttgacatccggtgctttcggtattacctcgctttcttcctttgcttgggtagcatcatatctccgtcg |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607173 |
ctgtcgtcattggtttggccatcgccggatttttgacatccggtgctttcggtattacctcgctttcttcctttgcttgggtagcatcatatctccgtcg |
43607272 |
T |
|
| Q |
408 |
ttcacggtttctggagaaggttaacgttaaac |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43607273 |
ttcacggtttctggagaaggttaacgttaaac |
43607304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University