View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19263_high_7 (Length: 341)
Name: NF19263_high_7
Description: NF19263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19263_high_7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 7 - 341
Target Start/End: Complemental strand, 21145052 - 21144718
Alignment:
| Q |
7 |
ggacatcatcatcactcaacaacgacaactctccccttaaatccacctcttgtacatcttcttttaacctagaaattctctcttacatcgaaccatgctc |
106 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21145052 |
ggacatcttcatcattcaacaacgacaactctccccttaaatccacctcttgtatatcttcttttaacctagaaattctctcttacatcgaaccatactc |
21144953 |
T |
 |
| Q |
107 |
ctccttgttccactctctaagccttcctttaaccccttttagtttctcttttaacacaaatcccatccatcacgttaaatgttgtgaattccacacctcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144952 |
ctccttgttccactctctaagccttcctttaaccccttttagtttctcttttaacagaaatcccatccatcacgttaaatgttgtgaattccacacctcc |
21144853 |
T |
 |
| Q |
207 |
tcaaccacctctttgatttgcctattatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcctcatcaaaatc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144852 |
tcaaccacctctttgatttgcctattatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcctcatcaaaatc |
21144753 |
T |
 |
| Q |
307 |
caagaactcaccaaattggtctccaatctgcttga |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144752 |
caagaactcaccaaattggtctccaatctgcttga |
21144718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University