View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19263_high_9 (Length: 208)
Name: NF19263_high_9
Description: NF19263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19263_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 90 - 192
Target Start/End: Original strand, 21144596 - 21144698
Alignment:
| Q |
90 |
attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaataactgtttggattaaaatcctaagtttaccagtt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21144596 |
attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaagaactgtttggattaaaatcctaagtttaccagtt |
21144695 |
T |
|
| Q |
190 |
cat |
192 |
Q |
| |
|
||| |
|
|
| T |
21144696 |
cat |
21144698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University