View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19264_low_26 (Length: 268)

Name: NF19264_low_26
Description: NF19264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19264_low_26
NF19264_low_26
[»] chr7 (2 HSPs)
chr7 (100-224)||(21286111-21286235)
chr7 (1-32)||(21286082-21286113)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 100 - 224
Target Start/End: Original strand, 21286111 - 21286235
Alignment:
100 atccaatatttctatttataacaaatagattcactatatcctttcttctatatgaatcgattcatatgaacgannnnnnnataaaatgtaaaaattccta 199  Q
    ||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||    
21286111 atccaatatttctgtttacaacaaatagattcacaatatcctttcttctatatgaatcgattcatatgaacgatttttttataaaatgtaaaaattccta 21286210  T
200 tataacccaagactttagataaaaa 224  Q
    ||||||||||||||||| |||||||    
21286211 tataacccaagactttacataaaaa 21286235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 21286082 - 21286113
Alignment:
1 tttgattagaatgaataacgaaacgattcatc 32  Q
    ||||||||||||||||||||||||||||||||    
21286082 tttgattagaatgaataacgaaacgattcatc 21286113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University