View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19265_high_10 (Length: 238)
Name: NF19265_high_10
Description: NF19265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19265_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 6088446 - 6088670
Alignment:
| Q |
2 |
aagtcttgaagctgatgaatggatcatgaaactagatgtctggctttcttgcctctacttgtgtgtggggatctcatttctctaagtctcctctcttgtg |
101 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6088446 |
aagtcttgaagctaatgaatggatcatgaaaccagatgcctggctttcttgcctctacttgtatgtggggatctcatttctctaagtctcctctcttgtg |
6088545 |
T |
 |
| Q |
102 |
aaagtatttttgctaacctgaatgtattagaataaaaatg----ttatctatgtaacaataattgtagcataattatactttgagtggtaattaaaatgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| | || || ||| |||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
6088546 |
aaagtatttttgctaacctgaatgtattagaataaatatgtcattaattaatataaaaataattgtaacataattataacttgagtggtaattaaaatgt |
6088645 |
T |
 |
| Q |
198 |
accatcactactggttaatcttaat |
222 |
Q |
| |
|
||| || ||||| || |||||||| |
|
|
| T |
6088646 |
accgtctctactaatttatcttaat |
6088670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 130
Target Start/End: Complemental strand, 46678426 - 46678358
Alignment:
| Q |
62 |
gtgtgtggggatctcatttctctaagtctcctctcttgtgaaagtatttttgctaacctgaatgtatta |
130 |
Q |
| |
|
||||| |||||| ||| ||||| ||| ||||||||||||| ||||||||||| |||||| ||| |||| |
|
|
| T |
46678426 |
gtgtgaggggatgtcaattctcgaagcttcctctcttgtgatagtatttttgcaaacctgcatgcatta |
46678358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University