View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19265_low_6 (Length: 346)
Name: NF19265_low_6
Description: NF19265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19265_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 37924002 - 37924228
Alignment:
| Q |
1 |
ctagcctagttgcatgtatacatagaacgttgaaaggaaagaacgaaacctcgactatttcttatctggctaatgttttcatggattttattttgtttca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37924002 |
ctagcctagttgcatgtatacatataacgttgaaaggaaagaacaaaacctcgactatttcttatctggctaatgttttcatggattttattttgtttca |
37924101 |
T |
 |
| Q |
101 |
gagtcagagattccccgcataataagggtatagattg-------tagtcaccatggcatatgatgtatccattgctatatttgggccattgagaatctct |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37924102 |
gagtcagagattccccgcataataagggtatagattgtagtcactagtcaccatggcatatgatgtatccattgctatatttgggccattgagaatctct |
37924201 |
T |
 |
| Q |
194 |
gtaccacaatgcttcataataagatct |
220 |
Q |
| |
|
||| ||||||||||||| ||||||||| |
|
|
| T |
37924202 |
gtaacacaatgcttcattataagatct |
37924228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University