View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19265_low_9 (Length: 239)
Name: NF19265_low_9
Description: NF19265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19265_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 30315079 - 30314858
Alignment:
| Q |
1 |
ttcaagtacgttaaagggaatgattcggttcttgtggtgaagaaagaagactatgattcttgcaacaccaacaatccaaaacaaaaattggacaatggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30315079 |
ttcaagtacgttaaagggaatgattcggttcttgtggtgaagaaagaagactatgattcttgcaacaccaacaatccaaaacaaaaattggacaatggta |
30314980 |
T |
|
| Q |
101 |
attccaagtttaagctgagtgactcgggtttctattatttcatcagtggcaatgctgacaactgcaagcatgatgaaaagatgactgttcaagtcatggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30314979 |
attccaagtttaagctgagtgactcgggtttctattatttcatcagtggcaatgctgacaactgcaagcatgatgaaaagatgattgttcaagtcatggc |
30314880 |
T |
|
| Q |
201 |
tgttcgccctaatgtcacacct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30314879 |
tgttcgccctaatgtcacacct |
30314858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University