View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_100 (Length: 239)
Name: NF19266_high_100
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_100 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 219
Target Start/End: Original strand, 49493778 - 49493995
Alignment:
| Q |
2 |
cttctccacaggaaaatgatggccgatcatcaacttaatggcgctcactatggcccttccatcccaccgacgagaccacaaaggcgacgccacaatgccg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49493778 |
cttctccacaggaaaatgatggccgatcatcaacttaatggcgctcactatggcccttccatcccaccgacgagaccacaaaggcgacgccacaatgccg |
49493877 |
T |
 |
| Q |
102 |
gctgcggcttctgcagttgcatcttgggctgctttagaagctgttgcggatgcatgttcaactgcattttaagcctaatttgcagaatcatagccacaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49493878 |
gctgcggcttctgcagttgcatcttgggctgctttagaagctgttgcggatgcatgttcaactgcattttaagcctaatttgcagaatcatagccacaat |
49493977 |
T |
 |
| Q |
202 |
catcatcttggcggcaat |
219 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
49493978 |
catcatcttggtggcaat |
49493995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University