View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_104 (Length: 236)
Name: NF19266_high_104
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_104 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 117 - 188
Target Start/End: Original strand, 23075212 - 23075283
Alignment:
| Q |
117 |
taaagttaaccaagtattttgatcctctaaaatatcttcttctacataaatgcttcttgtttcttctttcca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075212 |
taaagttaaccaagtattttgatcctctaaaatatcttcttctacataaatgcttcttgtttcttctttcca |
23075283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 23075322 - 23075362
Alignment:
| Q |
183 |
tttccaacttgtggctattgtcacttataagcttgtttctg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075322 |
tttccaacttgtggctattgtcacttataagcttgtttctg |
23075362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 23075096 - 23075126
Alignment:
| Q |
1 |
tagtgtccatttatcacaggaacctgaaggt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23075096 |
tagtgtccatttatcacaggaacctgaaggt |
23075126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University